Czech J. Food Sci. Vol. 27, 2009, S

Czech J. Food Sci. Vol. 27, 2009, Special Issue 2: S2-75–S2-81

Table 1. Primers used in PCR

Primer Sequence (5'-3') Product size (bp) Source
Papain 1–3 GGGCATTCTCAGCTGTTGTA 211 Goda et al. (2001)
Papain 1–5 CGACAATAACGTTGCACTCC
35S-F CCGACAGTGGTCCCAAAGATGGAC 162 Vollenhofer et al. (1999)
35S-R ATATAGAGGAAGGGTCTTGCGAAGG

evaluation, spectrophotometer NanoPhotometer (Implen, Munich, Germany) was used. Absorbancy at 260 nm, 280 nm, and 320 nm was measured and spectra profile (from 190 nm to 760 nm) recorded. Purity was calculated based on A260/A280 ratios.

PCR. The DNA amplifiability was verified by amplification of 211 pb long stretch of species specific gene papain. For primer sequence see Table 1.

Detection of papain. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End concentrations of PCR components were as follow: Gold buffer 1×; MgCl2 2mM; dNPTs (Fer-mentas, Burlington, Canada) 0.2mM; primer papain 1–3 0.5µM; primer papain 1–5 0.5µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reac-tion in case of genomic positive control or 10 ng DNA in case of plasmid positive control).

Amplification was performed in PCR thermal cycler (MJ Research, Waltham, USA) and consisted of: 12 min at 95°C; 41 cycles with 30 s at 95°C, 30 s at 60°C, 30 s at 72°C and 10 min at 72°C.

Detection of CaMV 35S promoter. For detec-tion of transgenic sequence, 162 bp string of 35S

CaMV promoter was used. For primer sequence see Table 1. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End con-centrations of PCR components were as follow: Gold buffer 1×; MgCl2 1.5mM; dNPTs (Fermen-tas, Burlington, Canada) 0.2mM; primer 35S-F 0.24µM; primer 35S- R 0.24µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reaction in case of positive controls).

Amplification was performed in PCR thermal cycler MJTB (MJ Research, Waltham, USA) and consisted of: 12 min at 95°C; 41 cycles with 30 s at 95°C, 30 s at 66°C, 30 s at 72°C; and s 10 min at 72°C.
Data evaluation. All isolations and amplifica-tions were run in duplicates. Positive, extraction and MasterMix controls were always included. As the positive control for papaya internal gene ampli-fication, the plasmid containing papain target se-quence was used. This plasmid (pPCR® 2.1-TOPO®) was prepared in our laboratory by insertion of 211 bp of papain target sequence using TOPO® TA Cloning Kit (Invitrogen, Carlsbad, USA). Al-ternativelly, isolated DNA from transgenic papaya

Table 2. Spectrophotometry measurement of isolated DNAs

Papaya matrix DNA isolation protocol Gel elfo DNA quantity (ng/µl) Amplifiability
CTAB – 1 +
Flesh Wizard – – –
GeneSpin – – –
CTAB + 7 +
Stone Wizard – – –
GeneSpin – – –
CTAB – – –
Candied Wizard – – –
GeneSpin – – +

evaluation, spectrophotometer NanoPhotometer (Implen, Munich, Germany) was used. Absorbancy at 260 nm, 280 nm, and 320 nm was measured and spectra profile (from 190 nm to 760 nm) recorded. Purity was calculated based on A260/A280 ratios.

PCR. The DNA amplifiability was verified by amplification of 211 pb long stretch of species specific gene papain. For primer sequence see Table 1.

Detection of papain. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End concentrations of PCR components were as follow: Gold buffer 1×; MgCl2 2mM; dNPTs (Fer-mentas, Burlington, Canada) 0.2mM; primer papain 1–3 0.5µM; primer papain 1–5 0.5µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reac-tion in case of genomic positive control or 10 ng DNA in case of plasmid positive control).

Amplification was performed in PCR thermal cycler (MJ Research, Waltham, USA) and consisted of: 12 min at 95°C; 41 cycles with 30 s at 95°C, 30 s at 60°C, 30 s at 72°C and 10 min at 72°C.

Detection of CaMV 35S promoter. For detec-tion of transgenic sequence, 162 bp string of 35S

CaMV promoter was used. For primer sequence see Table 1. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End con-centrations of PCR components were as follow: Gold buffer 1×; MgCl2 1.5mM; dNPTs (Fermen-tas, Burlington, Canada) 0.2mM; primer 35S-F 0.24µM; primer 35S- R 0.24µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reaction in case of positive controls).

Amplification was performed in PCR thermal cycler MJTB (MJ Research, Waltham, USA) and consisted of: 12 min at 95°C; 41 cycles with 30 s at 95°C, 30 s at 66°C, 30 s at 72°C; and s 10 min at 72°C.
Data evaluation. All isolations and amplifica-tions were run in duplicates. Positive, extraction and MasterMix controls were always included. As the positive control for papaya internal gene ampli-fication, the plasmid containing papain target se-quence was used. This plasmid (pPCR® 2.1-TOPO®) was prepared in our laboratory by insertion of 211 bp of papain target sequence using TOPO® TA Cloning Kit (Invitrogen, Carlsbad, USA). Al-ternativelly, isolated DNA from transgenic papaya

Table 2. Spectrophotometry measurement of isolated DNAs

Papaya matrix DNA isolation protocol Gel elfo DNA quantity (ng/µl) Amplifiability
 CTAB – 1 +
Flesh Wizard – – –
 GeneSpin – – –
 CTAB + 7 +
Stone Wizard – – –
 GeneSpin – – –
 CTAB – – –
Candied Wizard – – –
 GeneSpin – – +

0/5000

Dari: -

Ke: -

Hasil (Bahasa Indonesia) 1: [Salinan]

Disalin!

Ceko J. makanan Sci. Vol. 27, 2009, khusus edisi 2: S2-75-S2-81 Tabel 1. Primers digunakan dalam PCR Primer urutan (5' - 3') ukuran Produk (bp) sumberPapain 1-3 GGGCATTCTCAGCTGTTGTA 211 Goda et al. (2001)Papain 1-5 CGACAATAACGTTGCACTCC 35S-F CCGACAGTGGTCCCAAAGATGGAC 162 Vollenhofer et al. (1999)ATATAGAGGAAGGGTCTTGCGAAGG 35S-R evaluasi, Spektrofotometer NanoPhotometer (Implen, München, Jerman) digunakan. Absorbancy di 260 nm, 280 nm, dan 320 nm diukur dan spektrum profil (dari 200 nm 760 nm) tercatat. Kemurnian dihitung berdasarkan rasio A260/A280.PCR. DNA amplifiability diverifikasi oleh amplifikasi 211 pb bentangan panjang spesies gen tertentu papain. Untuk urutan primer Lihat tabel 1.Deteksi Papain. Amplifikasi reaksi (25 μL) dilakukan menggunakan reagen AmpliTaq emas PCR (Biosystems diterapkan, Forster City, Amerika Serikat). Akhir PCR komponen adalah sebagai berikut: emas penyangga 1 ×; MgCl2 2mM; dNPTs (Fer-mentas, Burlington, Kanada) 0.2 mM; primer papain 1-3 0.5µM; primer papain 1-5 0.5µM; AmpliTaq emas polimerase 1 U. Volume telah disesuaikan dengan air untuk PCR untuk 20 μL. PCR ini dilakukan dengan menggunakan 5 μL template DNA (DNA ng 100 di reac-tion dalam genom kontrol positif atau 10 ng DNA dalam kasus plasmid positif kontrol).Amplifikasi dilakukan di pengendara-sepeda termal PCR (MJ penelitian, Waltham, Amerika Serikat) dan terdiri dari: 12 min pada 95° C; 41 siklus dengan 30 s di 95° C, 30 s di 60° C, 30 s di 72° C dan 10 min di 72° C.Deteksi CaMV 35S promotor. Untuk trojanny-tion transgenik urutan, 162 bp serangkaian 35S Promotor CaMV digunakan. Untuk urutan primer Lihat tabel 1. Amplifikasi reaksi (25 μL) dilakukan menggunakan reagen AmpliTaq emas PCR (Biosystems diterapkan, Forster City, Amerika Serikat). Akhir con-centrations PCR komponen adalah sebagai berikut: emas penyangga 1 ×; MgCl2 1.5 mM; dNPTs (Fermen-tas, Burlington, Kanada) 0.2 mM; primer 35S-F 0.24µM; primer 35S-R 0.24µM; AmpliTaq emas polimerase 1 U. Volume telah disesuaikan dengan air untuk PCR untuk 20 μL. PCR ini dilakukan dengan menggunakan 5 μL template DNA (DNA ng 100 reaksi dalam hal positif kontrol).Amplifikasi dilakukan di PCR termal pengendara sepeda MJTB (MJ penelitian, Waltham, Amerika Serikat) dan terdiri dari: 12 min pada 95° C; 41 siklus dengan 30 s di 95° C, 30 s di 66° C, 30 s di 72° C; dan s 10 min di 72° C.Evaluasi data. Semua isolations dan amplifica-tions dijalankan dalam duplikat. Positif, ekstraksi dan MasterMix kontrol yang selalu disertakan. Sebagai kontrol positif untuk pepaya internal gen ampli-yang, plasmid yang mengandung papain target se-quence digunakan. Plasmid ini (pPCR ® 2.1-TOPO ®) disiapkan di laboratorium kami oleh penyisipan 211 bp papain target urutan menggunakan TOPO ® TA kloning Kit (Invitrogen, Carlsbad, Amerika Serikat). Al-ternativelly, terisolasi DNA dari transgenik pepaya Tabel 2. Spektrofotometri pengukuran terisolasi DNAsPepaya matriks DNA isolasi protokol Gel elfo DNA kuantitas (ng/μL) Amplifiability CTAB-1 +Daging Wizard- - GeneSpin- - CTAB + 7 +Batu Wizard- - GeneSpin- - CTAB- -Manisan Wizard- - GeneSpin – +

Sedang diterjemahkan, harap tunggu..

Hasil (Bahasa Indonesia) 2:[Salinan]

Disalin!

Sedang diterjemahkan, harap tunggu..

Hasil (Bahasa Indonesia) 3:[Salinan]

Disalin!

Sedang diterjemahkan, harap tunggu..

Bahasa lainnya

Dukungan alat penerjemahan: Afrikans, Albania, Amhara, Arab, Armenia, Azerbaijan, Bahasa Indonesia, Basque, Belanda, Belarussia, Bengali, Bosnia, Bulgaria, Burma, Cebuano, Ceko, Chichewa, China, Cina Tradisional, Denmark, Deteksi bahasa, Esperanto, Estonia, Farsi, Finlandia, Frisia, Gaelig, Gaelik Skotlandia, Galisia, Georgia, Gujarati, Hausa, Hawaii, Hindi, Hmong, Ibrani, Igbo, Inggris, Islan, Italia, Jawa, Jepang, Jerman, Kannada, Katala, Kazak, Khmer, Kinyarwanda, Kirghiz, Klingon, Korea, Korsika, Kreol Haiti, Kroat, Kurdi, Laos, Latin, Latvia, Lituania, Luksemburg, Magyar, Makedonia, Malagasi, Malayalam, Malta, Maori, Marathi, Melayu, Mongol, Nepal, Norsk, Odia (Oriya), Pashto, Polandia, Portugis, Prancis, Punjabi, Rumania, Rusia, Samoa, Serb, Sesotho, Shona, Sindhi, Sinhala, Slovakia, Slovenia, Somali, Spanyol, Sunda, Swahili, Swensk, Tagalog, Tajik, Tamil, Tatar, Telugu, Thai, Turki, Turkmen, Ukraina, Urdu, Uyghur, Uzbek, Vietnam, Wales, Xhosa, Yiddi, Yoruba, Yunani, Zulu, Bahasa terjemahan.