2.1.1 Antibiotic production assayDu

2.1.1 Antibiotic production assay
Due to their potential industrial significance, we aimed to thoroughly investigate antibiotic
secreting abilities among the screened APSs. Secondarily screened APSs and blank
controls were grown in 50 ml of respective liquid growth medium (TSB, PDB, and NB) at
37ºC, 120 rpm for 24 h. Cells were pelleted (OD600 2.2-2.5) by centrifugation at 22ºC,
10,000g for 10 min. The supernatant was collected and evaporated by sterile airflow
incubation at 37ºC. Desiccated supernatant was sterilized and reconstituted in 1 ml
respective growth medium and stored at -20ºC until analyzed for antibiotic properties
through agar-plug assay.
2.3 Agar-Plug Assay
Agar-plug assay was adopted from Bechard et al. [11] with a 5-mm sterile cork borer utilized
to plug wells on respective agar plates (NA, PDA, and TSA) lawned with pathogens. Each
well was filled with 20 µL of reconstituted supernatant, respectively. In parallel, blank growth
medium with no organism was evaporated, reconstituted, and loaded in a well within each
respective plate. The latter were incubated at 37ºC and examined for ZOI, a clear halo
around the wells, after regular time intervals (12 h, 16 h, 24 h, and 32 h). Isolates displaying
remarkable inhibitory properties were kept for further analysis. APS with little inhibitory
properties were retested at 30 µL and 40 µL per well and discarded if insufficient antibiotic
biosynthesis persisted. We utilized photographic pixel quantification (Adobe Photoshop CS6)
to distinguish which isolates developed the most unpenetrated inhibitory perimeters [12]. The
difference in pixel density between the streaked plates and its ZOI area was calculated and
used to assign an inhibitory potency value ranging from 0-5 to each isolate; the sum of these
values determined the Antibiotic Potency (A.P). The latter, along with ZOI diameter
measurements and the range of pathogenic inhibition (i.e. number of pathogens inhibited),
was used to calculate the Pathogenic Inhibitory Index (P.I.I) of each isolate, providing a
holistic view isolates’ growth inhibition potentials:
2.4 Plasmid DNA Extraction
The screened APSs were characterized for the presence of pDNA. pDNA was isolated from
overnight grown APSs (OD600 2.2-2.5) using PureLink
TM
Quick Plasmid Miniprep kit
(Invitrogen, USA). The isolated pDNA was visualized on 1% (w/v) agarose gel
electrophoresis stained with ethidium bromide.
2.5 Phylogenetic Analysis
Cellular DNA from three APSs: Y14p, Y16 and Y40p, which shared analogous morphologies
and growth inhibitory properties as most soil isolates, was extracted using PureLink™
Genomic DNA MiniKit K1820-01 (Invitrogen, USA). The 16S rRNA gene sequences from
these three APSs were then amplified using universal primer (F-518:
CCAGCAGCCGCGGTAATACG, R-800: TACCAGGGTATCTAATCC) and sequenced at
Macrogen Service Center (Rockville, MD, USA). All sequences were compared with closest
British Microbiology Research Journal, 3(3): 280-294, 2013
284
relatives from GenBank and Ribosomal Database Project (RDP) release 10
(http://rdp.cme.msu.edu/index.jsp). Phylogenetic trees were constructed by neighbor-joining
method (NJ) with pairwise deletion of gaps in RDP database.
2.5.1 Nucleotide sequence accession numbers
The sequences of all pure cultures have been deposited in GenBank database under
accession numbers JQ956432, JQ956433, and JX121858 for Y14, Y16, and Y40,
respectively.
2.6 Statistical Analysis
All experiments were carried out in triplicate, and the experimental results represent the
mean of three identical sets of experiments. One-way ANOVAs followed by least significant
difference (Tukey’s honestly significant difference) were performed to evaluate the potential
significant differences.
3. RESULTS AND DISCUSSION
3.1 Isolation of Antibiotic-Producing Microorganisms
The primary screening of residential and recreational soils yielded a total of 71 and 9
promising APS with growth inhibitory properties, respectively (Table 1). On NA medium, 52
(73.2%) isolates from residential soil displayed growth inhibitory zones against 19
pathogenic microorganisms, while all nine (100.0%) isolates from recreational soil displayed
inhibitory properties (Table 1). A total of 12 (16.9%) isolates from residential soil showed
inhibitory zones on PDA plates, but only seven (9.9%) demonstrated inhibitory zones on
TSA medium (Table 1).
Table 1. Count of residential and recreational soil isolates displaying antibioticproducing capacities at different screening stages
NA PDA TSA
Screening
stage
n Res. Rec. Res. Rec. Res. Rec.
Primary 80 52
(*73.2%)
9
(*100.0%)
12
(16.9%)
--- 7
(9.9%)
---Secondary 20 11
(*21.2%)
1
(*11.1%)
4
(*33.3%)
--- 4
(*57.5%)
---Agar-plug
assay
15 8
(*88.9%)
1
(*100.0%)
2
(*100.0%)
--- 4
(*100.0%)
---%= population remaining from screening. *P = .05
All isolates selected from primary screening were re-screened by PCPM. Most isolates
obtained from recreational sites showed insufficient inhibitory capacities against all nineteen
pathogenic microorganisms during secondary screening. Only one isolate (L59) from
recreational sites insistently exhibited growth inhibitory properties, inhibiting B. cereus, C.
albicans, P. fluorescence, S. aureus, and S. zooepidemicus on NA medium (Table 2). The
broad range of isolates from residential soil samples, i.e. 11 (21.2%), 4 (33.3%), and 4
(57.5%) isolates, displayed sufficient growth inhibitory properties on NA, PDA, and TSA
British Microbiology Research Journal, 3(3): 280-294, 2013
285
media, respectively (Table 1). Recreational soil did not reveal isolates with growth inhibitory
properties on TSA or PDA medium, and overall yielded nearly six times less APS than
residential soil (Table 1, P = .05).
Table 2. Soil isolates displaying robust growth inhibitory properties after secondary
screenings by cross-plate assay against 19 pathogens on three different media
ATCC
Pathogens
Gram
staining
PDA NA TSA
B. cereus + Y14, Y13 Y17, Y29, Y40, L59 Y64a
L. monocytogenes + --- Y10, Y49, Y16 Y66, Y64a, Y67,
Y63, Y64b
C. albicans Yeast Y14 Y40, Y29, Y16a, Y17, L59 Y64
E. coli - Y13 --- ---En.
saccharolyticus
+ --- Y8, Y10, Y21, Y23, Y40,
Y17, Y29, Y39
Y64a, Y63, Y67,
Y66
En. faecalis + --- --- Y63, Y64a
K. kristiniae + Y11,
Y13,
Y69, Y14
Y8, Y21, Y40, Y44, Y49,
Y16, Y16a
Y67, Y63, Y64a
K. pneumonia - --- --- Y64, Y66
K. oxytoca - --- ---M. luteus + Y13, Y14 Y23 Y63, Y64a
O. anthropi - Y11 Y8, Y40, Y49, Y16a Y64b
P. fluorescence - Y13, Y14 Y17, Y29, Y40, L59 ---S. cerevisiae Yeast Y13, Y14 Y16, Y17 Y64a, Y63
S. marcescess - --- Y23 ---S. aureus + Y14 Y51, Y17, Y29, Y49, L59 Y67
S. sciuri + --- Y40, Y49, Y44, Y16, Y16a Y64a, Y63,
Y64b, Y67
S. zooepidemicus + --- Y17, Y29, Y40, L59 Y63
S. pneumoniae + --- Y40 Y64a, Y66
S. thermophilus + --- ---Y= residential soil derived; L= recreational soil derived.
To determine the potential extracellular production of antibiotics from isolates screened by
PCPM, agar plug assay was used. A total of eight (88.89%; i.e. Y40p, Y17p, Y29p, Y16,
Y16a, Y39, Y44, and Y49), four (100.0%; i.e. Y63p, Y67p, Y64a, and Y64b) and two (100%;
i.e. Y13 and Y67p) isolates with growth inhibitory zone formations on NA, TSA, and PDA
media respectively revealed extracellular antibiotic production abilities (Table 1). The single
remaining recreational soil-derived isolate (L59) persisted through this screening. Overall, a
total of 15 different antibiotic-producing isolates with sufficient inhibitory potential were
isolated and further characterized. The single remaining recreational soil-derived isolate
(L59) persisted through this screening. Overall, a total of 15 different antibiotic-producing
organisms with sufficient inhibitory potential were isolated and further characterized. During
our study, isolates’ inhibitory capacities alternated at different screening stages. At some
stages they displayed growth suppressive abilities towards certain pathogens but lost or
switched these inhibitory abilities toward other pathogens during a different screening stage
(Table 1-2). These observations may indicate the presence of highly spontaneous antibioticspecificity swapping involved interdependently in antibiotic synthesis between soil isolates
British Microbiology Research Journal, 3(3): 280-294, 2013
286
within an optimal microenvironment, and support previous studies which specify the robust
influence of neighboring microorganisms on surrounding bacterial antibiotic secretion [13].
3.2 Growth-Inhibitory Assessment
Individual values of average zone of inhibition (ZOI) of each isolate are summarized in Table
3, and reveal Y14 with the largest ZOI (10.16mm), demonstrated against pathogen K.
kristinae on PDA media. Isolate Y13 exhibited its maximum inhibitory perimeter against S.
marcescess (9.40mm). Y14p and Y44 displayed their maximum inhibitory perimeters against
K. kristinae (10.16mm and 2.01mm, respectively). Y16 and Y67p displayed their largest
inhibitory perimeters against L. monocytogenes (2.54mm and 2.54mm). Y16a revealed
maximum ZOI against O. anthropi (2.54mm). The isolate Y17p exhibited its maximum
inhibitory perimeter against P. fluorescence, C. albicans and S. aureus (2.54mm, 2.54 mm,
and 2.54 mm). Y29p displayed its largest inhibitory zone against P. fluorescence and S.
aureus (2.54mm and 2.54mm). Similarly, Y39 had its greatest inhibitory perimeter against
En. saccharolyticus (2.29mm). Y40p greatest inhibitory perimeter was against P.
fluorescence (2.54mm). The isolates Y49 and L59 maximum

Hasil (Bahasa Indonesia) 1:

2.1.1 antibiotik produksi assay
karena signifikansi industri yang potensial, kami bertujuan untuk melakukan penyidikan menyeluruh antibiotik
mensekresi kemampuan antara APSs disaring. Sekunder disaring APSs dan kosong
kontrol yang ditanam di 50 ml media pertumbuhan cair masing-masing (TSB, PDB dan NB) di
37ºC, 120 rpm untuk 24 h. sel adalah pelleted (OD600 2.2-2,5) oleh sentrifugasi di 22ºC,
10,000g untuk 10 menit. Supernatant dikumpulkan dan menguap oleh aliran udara steril
inkubasi di 37ºC. Tepung supernatant disterilkan dan dilarutkan dalam 1 ml
masing-masing pertumbuhan menengah dan disimpan di - 20ºC sampai dianalisis untuk sifat antibiotik
melalui agar-agar-plug assay.
2.3 Assay Agar-Plug
assay Agar-plug diadopsi dari Bechard et al. [11] dengan bor 5-mm steril gabus yang digunakan
untuk plug sumur di piring masing-masing agar (NA, PDA dan TSA) lawned dengan patogen. Setiap
juga dipenuhi dengan 20 μL dari dilarutkan supernatant, masing-masing. Secara paralel, kosong pertumbuhan
menengah dengan organisme tidak menguap, dilarutkan, dan dimuat dalam sebuah sumur dalam masing-masing
piring masing-masing. Yang terakhir adalah burung di 37ºC dan diperiksa untuk ZOI, lingkaran jelas
di sekitar wells, setelah interval waktu yang teratur (12 h, 16 h, 24 h, dan 32 h). Mengisolasi menampilkan
properti penghambatan luar biasa dipelihara untuk analisa lebih lanjut. APS dengan sedikit penghambatan
properti diuji ulang di μL 30 dan 40 μL per baik dan dibuang jika tidak mencukupi antibiotik
biosintesis bertahan. Kami menggunakan fotografi pixel kuantifikasi (Adobe Photoshop CS6)
untuk membedakan isolat yang dikembangkan strategis penghambatan paling unpenetrated [12].
Perbedaan dalam kerapatan piksel dalam piring dan ZOI area dihitung dan
digunakan untuk menetapkan nilai potensi penghambatan mulai dari 0-5 untuk masing-masing isolat; jumlah ini
nilai ditentukan antibiotik potensi (A.P). Yang terakhir, bersama dengan ZOI diameter
pengukuran dan kisaran patogen inhibisi (yaitu nomor patogen dihambat),
digunakan untuk menghitung patogen penghambatan Index (P.I.I) dari setiap isolat, menyediakan
potensi penghambatan pertumbuhan pandangan holistik isolat:
2.4 isolasi DNA Plasmid
APSs disaring ditandai untuk kehadiran pDNA. pDNA begitu diisolasikan
semalam tumbuh APSs (OD600 2.2-2.5) menggunakan PureLink
TM
cepat Plasmid Miniprep kit
(Invitrogen, USA). PDNA terisolasi divisualisasikan pada 1% (w/v) agarose gel
Elektroforesis ternoda dengan ethidium bromida.
2.5 analisis filogenetik
DNA selular dari tiga APSs: Y14p, Y16 dan Y40p, yang bersama analog morfologi
dan properti penghambatan pertumbuhan seperti kebanyakan tanah mengisolasi, diambil menggunakan PureLink ™
DNA genom MiniKit K1820-01 (Invitrogen, USA). 16S rRNA gen urutan dari
APSs ini tiga itu kemudian diperkuat menggunakan universal primer (F-518:
CCAGCAGCCGCGGTAATACG, R-800: TACCAGGGTATCTAATCC) dan sequencing di
Macrogen Service Center (Rockville, MD, USA). Semua urutan dibandingkan dengan terdekat
British Journal riset mikrobiologi, 3(3): 280-294, 2013
284
kerabat dari GenBank dan Ribosomal Database proyek (RDP) rilis 10
(http://rdp.cme.msu.edu/index.jsp). Filogenetik dibangun oleh bergabung dengan tetangga
metode (NJ) dengan penghapusan pairwise kesenjangan dalam RDP database.
2.5.1 nomor aksesi urutan nukleotida
urutan-urutan semua murni budaya telah disimpan dalam database GenBank di bawah
aksesi nomor JQ956432, JQ956433, dan JX121858 Y14, Y16 dan Y40,
masing-masing.
2.6 analisis statistik
semua percobaan dilakukan dalam rangkap tiga, dan hasil percobaan mewakili
berarti tiga identik set percobaan. Sekali jalan ANOVAs, diikuti oleh paling signifikan
perbedaan (Tukey's jujur signifikan perbedaan) dilakukan untuk mengevaluasi potensi
perbedaan signifikan.
3. HASIL dan diskusi
3.1 Mikroorganisme menghasilkan isolasi antibiotik
pemutaran utama tanah tempat tinggal dan rekreasional menghasilkan total 71 dan 9
menjanjikan APS dengan pertumbuhan properti penghambatan, masing-masing (Tabel 1). Pada media NA, 52
(73.2%) isolat dari tanah perumahan ditampilkan pertumbuhan zona penghambatan terhadap 19
mikroorganisme patogen, sementara semua sembilan (100.0%) isolat dari rekreasi tanah ditampilkan
properti penghambatan (Tabel 1). Total 12 (16.9%) isolat dari perumahan tanah menunjukkan
penghambatan zona pada PDA piring, tetapi hanya tujuh (9,9%) menunjukkan penghambatan zona pada
TSA menengah (Tabel 1).
tabel 1. Jumlah tanah tempat tinggal dan rekreasional mengisolasi menampilkan antibioticproducing kapasitas berbeda penyaringan tahap
NA PDA TSA
Skrining
tahap
n Res. Rekam Res. Rekam Res. Rekam
80 utama 52
(*73.2%)
9
(*100.0%)
12
(16.9%)
---7
(9.9%)
---sekunder 20 11
(*21.2%)
1
(*11.1%)
4
(*33.3%)
---4
(* 92.5%)
---Agar-plug
assay
15 8
(*88.9%)
1
(*100.0%)
2
(*100.0%)
---4
(*100.0%)
---% = populasi yang tersisa dari skrining. * P =. 05
ternyata semua isolat yang dipilih dari penyaringan primer kembali diputar oleh PCPM. Kebanyakan isolat
Diperoleh dari situs rekreasi menunjukkan kurangnya kapasitas penghambatan terhadap semua sembilan belas
patogen mikroorganisme selama pemeriksaan sekunder. Hanya satu mengisolasi (L59) dari
situs rekreasi terus-menerus dipamerkan properti penghambatan pertumbuhan, menghambat B. cereus, C.
albicans, P. fluorescence, S. aureus, dan S. zooepidemicus pada NA media (Tabel 2). The
berbagai macam isolat dari sampel tanah perumahan, yaitu 11 (21.2%), 4 (33,3%), dan 4
(57.5%) mengisolasi, cukup pertumbuhan ditampilkan properti penghambatan NA, PDA dan TSA
British Journal riset mikrobiologi, 3(3): 280-294, 2013
285
media, masing-masing (Tabel 1). Rekreasi tanah tidak mengungkapkan isolat dengan penghambatan pertumbuhan
properti di media TSA atau PDA, dan secara keseluruhan menghasilkan APS hampir enam kali lebih sedikit daripada
perumahan tanah (Tabel 1, P = 05).
Tabel 2. Tanah mengisolasi menampilkan properti penghambatan pertumbuhan yang kuat setelah menengah
pemutaran oleh salib-piring assay terhadap 19 patogen pada tiga media yang berbeda
ATCC
patogen
Gram
pewarnaan
PDA NA TSA
B. cereus Y14, Y13 Y17, Y29, Y40, L59 Y64a
L. monocytogenes---Y10, Y49, Y16 Y66, Y64a, Y67,
Y63, Y64b
C. albicans ragi Y14 Y40, Y29, Y16a, Y17, L59 Y64
E. coli - Y13------En.
saccharolyticus
---dan8, Y10, Y21, Y23, Y40,
Y17, Y29, Y39
Y64a, Y63, Y67,
Y66
En. faecalis------Y63, Y64a
kristiniae K. Y11,
Y13,
Y69, Y14
dan8, Y21, Y40, Y44, Y49,
Y16, Y16a
Y67, Y63, Y64a
K. radang paru-paru -------Y64, Y66
K. oxytoca -------M. luteus Y13, Y14 Y23 Y63, Y64a
anthropi O. - dan8 Y11, Y40, Y49, Y16a Y64b
P. fluorescence - Y13, Y14 Y17, Y29, Y40, L59---S. cerevisiae ragi Y13, Y14 Y16, Y17 Y64a, Y63
S. marcescess ----Y23---S. aureus Y14 Y51, Y17, Y29, Y49, L59 Y67
S. sciuri---Y40, Y49, Y44, Y16, Y16a Y64a, Y63,
Y64b, Y67
S. zooepidemicus---Y17, Y29, Y40, L59 Y63
S. pneumoniae---Y40 Y64a, Y66
S. thermophilus------Y = perumahan tanah berasal; L = rekreasi tanah berasal.
untuk menentukan potensi produksi ekstraseluler antibiotik dari isolat disaring oleh
PCPM, assay plug agar-agar digunakan. Total delapan (88.89%; yakni Y40p, Y17p, Y29p, Y16,
Y16a, Y39, Y44, dan Y49), empat (100,0%; yakni Y63p, Y67p, Y64a dan Y64b) dan dua (100%;
i.e. Y13 dan Y67p) mengisolasi dengan formasi zona penghambatan pertumbuhan NA, TSA dan PDA
Media masing-masing mengungkapkan kemampuan produksi antibiotik ekstraseluler (Tabel 1). Singel
rekreasi berasal dari tanah isolat (L59) yang tersisa bertahan melalui pemeriksaan ini. Secara keseluruhan,
sebanyak 15 berbeda memproduksi antibiotik isolat dengan potensi penghambatan cukup
terisolasi dan selanjutnya ditandai. Tunggal rekreasi tersisa tanah yang diturunkan isolat
(L59) bertahan melalui pemeriksaan ini. Secara keseluruhan, total 15 berbeda antibiotik memproduksi
organisme dengan potensi penghambatan cukup terisolasi dan selanjutnya ditandai. Selama
studi kami, isolat kapasitas penghambatan berganti-ganti di tahap penyaringan yang berbeda. Beberapa
tahap mereka ditampilkan pertumbuhan kemampuan penekanan terhadap patogen tertentu tetapi kehilangan atau
beralih kemampuan ini penghambatan terhadap patogen lain selama tahap penyaringan berbeda
(Tabel 1 - 2). Observasi ini mungkin menunjukkan kehadiran sangat spontan antibioticspecificity menukar terlibat interdependently dalam antibiotik sintesis antara tanah isolat
British Journal riset mikrobiologi, 3(3): 280-294, 2013
286
dalam mikro optimal, dan mendukung studi sebelumnya yang menentukan kuat
pengaruh tetangga mikroorganisme di sekitarnya sekresi antibiotik bakteri [13].
3.2 penghambatan pertumbuhan penilaian
nilai-nilai individu rata-rata zona inhibisi (ZOI) setiap isolat diringkas dalam tabel
3, dan mengungkapkan Y14 dengan ZOI terbesar (10.16 mm), menunjukkan terhadap patogen K.
kristinae PDA media. Mengisolasi Y13 dipamerkan pinggirannya penghambatan maksimum terhadap S.
marcescess (9,40 mm). Y14p dan Y44 ditampilkan mereka maksimum strategis penghambatan terhadap
K. kristinae (10.16 mm dan 2,01 mm, masing-masing). Y16 dan Y67p ditampilkan terbesar mereka
strategis penghambatan terhadap L. monocytogenes (2,54 mm dan 2,54 mm). Y16a mengungkapkan
maksimum ZOI terhadap O. anthropi (2,54 mm). Y17p mengisolasi dipamerkan maksimum yang
perimeter penghambatan terhadap P. fluorescence, C. albicans dan S. aureus (2,54 mm, 2.54 mm,
dan 2.54 mm). Y29p ditampilkan dalam zona penghambatan terbesar terhadap P. fluorescence dan S.
aureus (2,54 mm dan 2,54 mm). Demikian pula, Y39 telah pinggirannya penghambatan terbesar terhadap
En. saccharolyticus (2,29 mm). Y40p perimeter penghambatan terbesar adalah melawan P.
fluoresensi (2,54 mm). Maksimum isolat Y49 dan L59