Czech J. Food Sci. Vol. 27, 2009, S

Czech J. Food Sci. Vol. 27, 2009, Special Issue 2: S2-75–S2-81




Detection of Transgenic Papaya Lines: Extraction Protocol Optimisation and Verification of DNA Quality by PCR Assay

Jaroslava Ovesná and Jan Hodek


Department of Molecular Biology, Crop Research Institute, Prague-Ruzyně, Czech Republic

Abstract: Food matrices are controlled for the presence of authorised and unauthorised GMOs (Genetically Modified Organisms). Transgenic papaya was developed and approved for the market in the USA. However, authorisation in EC have not been accomplished. Recently, unauthorised GM papaya was catch on EC market. Therefore it is necessary to dispose by an assay revealing genetically modified fruits. High quality DNA is required for the assay. We tested and optimised CTAB, Wizard and spin column based procedure for DNA extraction. We found that CTAB based proto-col allows isolation of amplifiable DNA from fresh fruit flesh and stones, whereas spin columns alowed isolation of amplifiable DNA from candied fruits. Modified protocol is described. No transgenic fresh fruit or candied fruit from the market was detected.

Keywords: GMO detection; papaya; PCR; DNA isolation








Papaya is the fruit of the plant Carica papaya, in the genus Carica. It is native to the tropics of the Americas, and was cultivated in Mexico several centuries before the emergence of the Mesoameri-can classic cultures. Papaya (Carica papaya) is widely grown in the tropics and has been grown in Hawaii for over a century as well (Gonsalves 1998). It is a popular fruit. The juice has been seen to have an antiproliferative effect on liver cancer cells cultured in the laboratory, probably due to its component of lycopene (Rahmat et al. 2002).

A major production constraint for papaya world-wide is papaya ringspot virus (PRSV), a potyvirus that is rapidly transmitted by a number of aphid species in a nonpersistent manner (Gonsalves & Ishii 1980). Efforts to develop transgenic papaya to control PRSV began shortly after transgenic tobacco expressing the coat protein gene of to-bacco mosaic virus was developed and shown to be resistant to Tobacco mosaic virus. The papaya research team cloned the coat protein gene of PRSV, transformed embryogenic cultures of pa-








paya cvs. Sunrise, Sunset, and Kapoho (Fitch et al. 1990).

The team identified in 1991 a single line de-rived from cv. Sunset (designated line 55-1) that was resistant to PRSV HA (a severe strain from Hawaii) in greenhouse inoculations (Fitch et al. 1992). New transgenic cultivars were developed shortly SunUp and Rainbow. SunUp is a transgenic red- fleshed Sunset that is homozygous for the coat protein gene. Rainbow is a yellow-fleshed F1 hybrid developed by crossing SunUp and non-transgenic yellow- fleshed Kapoho (Manshardt 1998). Transgenic papaya has been grown widely on Hawaii (Schwember 2008). From the results it is clear that the PRSV-resistant transgenic papaya is a practical solution for controlling PRSV, as has been shown in Hawaii. Infection fields were replaced by transgenic cultivar and thus selec-tion preasure decreased and some production is non transgenic allowing export to e.g. Japan. In January 2003, Canada allowed the importation of transgenic papaya.


Supported by the Ministry of Agriculture of the Czech Republic, Projects No. 1B44068 PUV and No. MZE 0002700604, and by the Ministry of Education, Youth and Sports of the Czech Republic, Project No. MEB 080849.


S2-75

Vol. 27, 2009, Special Issue 2: S2-75–S2-81 Czech J. Food Sci.



European community does not allow import of transgenic papaya into its territory. European jurisdiction requires risk assessment by EFSA (European Food Safety Authority) before authori-sation. For details see EC Regulation 1829/2003. Recently unauthorised GM papaya was catch on EC market (Busch et al. 2004). To control the import detection methods are required. Gener-ally they are PCR based but others are under the development (Anklam et al. 2002; Liu et al. 2004; Monma et al. 2004; Mafra et al. 2008).

GMO contains foreign DNA usually consisting of promotor, coding sequence and terminator for both functional and marker genes. Often, CaMV 35S promoter is used in the construct. So that PCR based methods require isolated DNAs containing target DNA string. For details and principle see e.g. Ovesná et al. (2008). According GM database of the Agbios (AgBios GM Database), which is an internationally respected Canadian company dedicated to providing public policy, regulatory, and risk assessment expertise for products of biotechnology, there are two events of GM papaya event 55-1/63-1 and X17-2. Both traits are resist-ant to viral infection PRSV and both transgenic constructs contain CaMV 35S promoter. Schema of genes inserted into the papaya 55-1 is presented in Figure 1. The gus gene is not presented in line 63-1 compared to 55-1 line.

We aimed in our research to establish reliable protocol for isolation of DNA from raw and candied papaya fruit amplifiable by appropriate method, as the GM papaya is unapproved in EC and the DNA extraction from papaya products was revealed as problematic (Wall et al. 2004).

Here we describe optimised protocol and results of GM screening based on CaMV 35S promoter


p355 PRSVcp t355

p355 gus tNOS

Figure 1. Transgenic contruct of GM papaya. p35S = CaMV 35S promoter (CaMV – Cauliflower mosaic virus); PRSVcp = viral coat protein (PRSV – papaya ringspot potyvirus ); t35S = CaMV 35S terminator (CaMV – Cauliflower mosaic virus); gus = beta-d-glucuronidase (from Escherichia coli); tNOS = A. tumefaciens nopaline synthase (nos) 3'-untrans-lated region. Adapted according: AgBios GM Database and Wall et al. (2004)



of two most frequent food products on the Czech market – the fresh papaya fruit and the candied papaya.


MATERIAL AND METHODS

Material. Papaya samples were collected on the market. The fruit was peeled, the flesh was separated from the stones, cut into pieces and the slices of papaya flesh was dried in the oven at 37°C for 12 h to reduce the moisture content. Both the tissue were stored at –80°C until further processed.

The candied papaya was stored at room tem-perature until processed.
DNA isolation. From each sample two inde-pendent isolations were performed. Prior to DNA isolation, samples were homogenised in liquid nitrogen.

CTAB based DNA extraction. CTAB method (Cetyl trimethylammonium bromide) DNA isolota-tion was performed according ISO Standard (EN ISO 21571:2002). Total of 200 mg of powdered sample was used for DNA isolation. Extracted DNAs were eluted in 60 µl of 0.1 × TE buffer.

Wizard DNA extraction. DNAs were extracted and purified using the modified Wizard method. 200 mg of powdered sample was mixed with 860 µl of TNE buffer (5mM Tris-HCl, pH 8.0, 2mM EDTA, 150mM NaCl, 1% SDS). The mixture was vortexed. 100 µl of 5M guanidin hydrochloride and 40 µl of proteinase K hydrochloride were added to the solution, the mixture was vortexed and after that incubated at 58°C for 5 hours with occassionaly mix-ing. After incubation, the mixture was centrifuged for 10 min at 13 000 × g. 500 µl of supernatant was transferred into the new microtube and 10 µl of RNase was added to the sample. The sample was further incubated at 65°C for 10 minutes. DNA solu-tion was subsequently purified with Wizard DNA Clean-Up System (Promega, Madison, USA).

GeneSpin DNA Isolation Kit. DNA was extracted using GeneSpin DNA Extraction Kit (Eurofins, Freiburg, Germany) following the manufacturers instructions. Total of 200 mg of powdered sample was used. In the case of candied papaya the pro-tocol was modified as follows. The volume of lysis buffer increased to 700 µl and time of incubation was prolonged to 1 hour.

Assessment of DNA quality. DNAs were evalu-ated by agarose electrophoresis for its integrity and raugh estimation of quantity. For detailed


S2-76

Czech J. Food Sci. Vol. 27, 2009, Special Issue 2: S2-75–S2-81

Table 1. Primers used in PCR

Primer Sequence (5'-3') Product size (bp) Source
Papain 1–3 GGGCATTCTCAGCTGTTGTA 211 Goda et al. (2001)
Papain 1–5 CGACAATAACGTTGCACTCC
35S-F CCGACAGTGGTCCCAAAGATGGAC 162 Vollenhofer et al. (1999)
35S-R ATATAGAGGAAGGGTCTTGCGAAGG


evaluation, spectrophotometer NanoPhotometer (Implen, Munich, Germany) was used. Absorbancy at 260 nm, 280 nm, and 320 nm was measured and spectra profile (from 190 nm to 760 nm) recorded. Purity was calculated based on A260/A280 ratios.

PCR. The DNA amplifiability was verified by amplification of 211 pb long stretch of species specific gene papain. For primer sequence see Table 1.

Detection of papain. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End concentrations of PCR components were as follow: Gold buffer 1×; MgCl2 2mM; dNPTs (Fer-mentas, Burlington, Canada) 0.2mM; primer papain 1–3 0.5µM; primer papain 1–5 0.5µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reac-tion in case of genomic positive control or 10 ng DNA in case of plasmid positive control).

Amplification was performed in PCR thermal cycler (MJ Research, Waltham, USA) and consisted of: 12 min at 95°C; 41 cycles with 30 s at 95°C, 30 s at 60°C, 30 s at 72°C and 10 min at 72°C.

Detection of CaMV 35S promoter. For detec-tion of transgenic sequence, 162 bp string of 35S


CaMV promoter was used. For primer sequence see Table 1. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End con-centrations of PCR components were as follow: Gold buffer 1×; MgCl2 1.5mM; dNPTs (Fermen-tas, Burlington, Canada) 0.2mM; primer 35S-F 0.24µM; primer 35S- R 0.24µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reac

Hasil (Bahasa Indonesia) 1:

Ceko J. makanan Sci. Vol. 27, 2009, khusus edisi 2: S2-75-S2-81Deteksi transgenik pepaya baris: ekstraksi protokol pengoptimalan dan verifikasi DNA kualitas oleh PCR AssayJaroslava Ovesná dan Jan HodekDepartemen biologi molekuler, tanaman Research Institute, Praha-Ruzyně, Republik CekoAbstrak: Matriks makanan dikendalikan untuk kehadiran resmi dan tidak sah GMO (Genetically Modified organisme). Pepaya transgenik dikembangkan dan disetujui untuk pasar di Amerika Serikat. Namun, otorisasi di EC telah tidak diselesaikan. Baru-baru ini, tidak sah GM pepaya menangkap EC pasar. Oleh karena itu sangatlah perlu untuk membuang dengan sebuah alat tes yang mengungkapkan buah-buahan yang dimodifikasi secara genetik. DNA berkualitas tinggi diperlukan untuk alat tes. Kami menguji dan dioptimalkan CTAB, Wizard dan spin kolom berdasarkan prosedur untuk isolasi DNA. Kami menemukan bahwa CTAB berbasis proto-col memungkinkan isolasi amplifiable DNA dari daging buah segar dan batu, sedangkan berputar kolom alowed isolasi amplifiable DNA dari manisan buah-buahan. Protokol dimodifikasi digambarkan. Tidak ada transgenik buah segar atau manisan buah-buahan dari pasar terdeteksi.Kata kunci: GMO deteksi; Pepaya; PCR; Isolasi DNA Pepaya adalah buah dari tanaman Carica pepaya, dalam genus Carica. Ini tanaman asli daerah tropis di Amerika, dan dibudidayakan di Meksiko beberapa abad sebelum munculnya budaya klasik Mesoameri-dapat. Papaya (pepaya) yang banyak tumbuh di daerah tropis dan telah berkembang di Hawaii untuk lebih dari satu abad serta (Gonsalves 1998). Ini adalah buah yang populer. Jus telah dilihat antiproliferative mempunyai efek pada sel-sel kanker hati berbudaya dalam laboratorium, mungkin karena komponen-komponen Likopen (Rahmat et al. 2002).Kendala utama produksi untuk pepaya seluruh dunia adalah pepaya ringspot virus (PRSV), potyvirus yang cepat ditransmisikan oleh sejumlah spesies aphid secara nonpersistent (Gonsalves & Ishii 1980). Upaya untuk mengembangkan pepaya transgenik untuk mengontrol PRSV dimulai setelah transgenik tembakau mengungkapkan mantel protein gen dari virus mosaik untuk bacco dikembangkan dan terbukti resisten terhadap virus mosaik tembakau. Tim peneliti pepaya kloning gen protein mantel dari PRSV, berubah budaya embriogenik pa- Paya cvs. Sunrise, matahari terbenam, dan Kapoho (Fitch et al., 1990).Tim diidentifikasi pada tahun 1991 satu baris de rived dari cv. Sunset (Ruangan Khusus garis 55 - 1) yang resisten terhadap PRSV HA (beban berat dari Hawaii) di rumah kaca inokulasi (Fitch et al. 1992). Baru transgenik kultivar dikembangkan lama SunUp dan pelangi. SunUp adalah merah transgenik - fleshed Sunset yang homozygous untuk mantel protein gen. Pelangi adalah hibrida F1 kuning-fleshed yang dikembangkan oleh crossing SunUp dan non-transgenik kuning - fleshed Kapoho (Manshardt 1998). Pepaya transgenik telah berkembang secara luas di Hawaii (Schwember 2008). Dari hasil sudah jelas bahwa transgenik pepaya tahan PRSV adalah solusi praktis untuk mengendalikan PRSV, seperti yang telah ditunjukkan di Hawaii. Infeksi bidang digantikan oleh budidaya transgenik dan dengan demikian selec-tion preasure menurun dan beberapa produksi bebas transgenik memungkinkan ekspor ke Jepang misalnya. Pada Januari 2003, Kanada diperbolehkan impor transgenik pepaya. Didukung oleh Departemen Pertanian Republik Ceko, proyek 1B44068 No. PUV dan No. MZE 0002700604, dan oleh Departemen Pendidikan, pemuda dan olahraga Republik Ceko, proyek No. MEB 080849. S2-75 Vol. 27, 2009, khusus edisi 2: S2-75-S2-81 Ceko J. makanan Sci. Masyarakat Eropa tidak memungkinkan impor transgenik pepaya ke wilayahnya. Eropa yurisdiksi memerlukan penilaian risiko oleh EFSA (otoritas keselamatan makanan Eropa) sebelum Yan-sation. Untuk rincian, lihat EC peraturan 1829/2003. Baru-baru ini tidak sah GM pepaya menangkap EC pasar (Busch et al. 2004). Untuk mengontrol impor metode pendeteksian diperlukan. Dan-sekutu mereka adalah PCR berbasis, tetapi orang lain yang sedang dikembangkan (Anklam et al. 2002; Liu et al. 2004; Monma et al. 2004; Mafra et al., 2008).GMO berisi DNA asing biasanya terdiri dari pengagas utama, pengkodean urutan dan terminator untuk kedua yang fungsional dan penanda gen. Sering, CaMV 35S promotor digunakan dalam membangun. Sehingga PCR berbasis metode memerlukan DNAs terisolasi yang berisi sasaran DNA string. Untuk rincian dan prinsip lihat misalnya Ovesná et al. (2008). Menurut database GM Agbios (AgBios GM Database), yang merupakan perusahaan Kanada dihormati di dunia internasional yang didedikasikan untuk menyediakan kebijakan publik, peraturan, dan keahlian penilaian risiko untuk produk bioteknologi, ada dua peristiwa GM pepaya acara 55-1/63-1 dan X 17-2. Kedua sifat semut menolak untuk infeksi virus PRSV dan konstruksi kedua transgenik mengandung CaMV 35S promotor. Skema gen yang dimasukkan ke dalam pepaya 55-1 disajikan dalam gambar 1. Gen gus tidak disajikan dalam garis 63-1 dibandingkan dengan 55-1 line.Kami bertujuan dalam penelitian kami membangun protokol yang reliable untuk isolasi DNA dari amplifiable dengan metode yang tepat, pepaya mentah dan manisan buah pepaya GM tidak disetujui di EC dan ekstraksi DNA dari produk pepaya terungkap sebagai bermasalah (dinding et al. 2004).Di sini kita menggambarkan dioptimalkan protokol dan hasil pemeriksaan GM berdasarkan CaMV 35S promotor p355 PRSVcp t355 p355 gus tNOS Gambar 1. Kesadahan transgenik GM pepaya. p35S = CaMV 35S promotor (CaMV-virus mosaik kembang kol); PRSVcp = mantel virus protein (PRSV-pepaya ringspot potyvirus); t35S = CaMV 35S terminator (CaMV-virus mosaik kembang kol); Gus = beta-d-glucuronidase (dari Escherichia coli); tNOS = A. tumefaciens nopaline sintase (nos) wilayah 3'-untrans-laranangan dan saksi. Disesuaikan menurut: AgBios GM Database dan dinding et al. (2004) dua produk makanan paling sering di pasar Ceko-buah pepaya segar dan pepaya manisan.BAHAN DAN METODEBahan. Pepaya sampel dikumpulkan di pasar. Buah kupas, daging terpisah dari batu, potong-potong dan irisan daging pepaya dikeringkan dalam oven di 37° C selama 12 h untuk mengurangi kadar air. Kedua jaringan disimpan pada –80 ° C sampai diproses lebih lanjut.Pepaya manisan disimpan di kamar tem-perature sampai diproses.Isolasi DNA. Dari setiap sampel dua inde-pendent isolations dilakukan. Sebelum isolasi DNA, sampel yang homogenised di dalam nitrogen cair.CTAB berbasis isolasi DNA. CTAB metode (setil trimethylammonium bromida) DNA isolota-tion dilakukan menurut standar ISO (EN ISO 21571:2002). Total 200 mg bubuk sampel digunakan untuk isolasi DNA. Diekstrak DNAs adalah eluted di 60 μL 0.1 × TE buffer.Isolasi DNA Wizard. DNAs diekstraksi dan dimurnikan menggunakan metode Wizard diubah. 200 mg bubuk sampel dicampur dengan 860 μL mentega buffer (5mM Tris-HCl, pH 8.0, 2mM EDTA, 150mM NaCl, SDS 1%). Campuran ini adalah vortexed. 100 μL dari 5M guanidin hidroklorida dan 40 μL proteinase K hydrochloride ditambahkan ke solusi, campuran adalah pada vortexed dan setelah itu diinkubasi 58° c selama 5 jam dengan occassionaly campuran-ing. Setelah inkubasi, campuran disentrifugasi min 10 jam 13 000 × g. 500 μL supernatant dipindahkan ke microtube baru dan 10 μL RNase ditambahkan ke sampel. Sampel lebih lanjut diinkubasi pada 65° C selama 10 menit. DNA solu-tion kemudian dimurnikan dengan Wizard DNA Clean-Up sistem (Promega, Madison, Amerika Serikat).Isolasi DNA GeneSpin Kit. DNA diambil menggunakan GeneSpin DNA ekstraksi Kit (Eurofins, Freiburg, Jerman) yang mengikuti petunjuk produsen. Total 200 mg bubuk sampel digunakan. Dalam kasus manisan pepaya pro-tocol diubah sebagai berikut. Volume lysis penyangga ditingkatkan 700 μL dan waktu inkubasi ini diperpanjang sampai 1 jam.Penilaian kualitas DNA. DNAs adalah evalu-mendatangkan oleh agarose Elektroforesis untuk estimasi dengan integritas dan raugh kuantitas. Untuk S2-76 Ceko J. makanan Sci. Vol. 27, 2009, khusus edisi 2: S2-75-S2-81 Tabel 1. Primers digunakan dalam PCR Primer urutan (5' - 3') ukuran Produk (bp) sumberPapain 1-3 GGGCATTCTCAGCTGTTGTA 211 Goda et al. (2001)Papain 1-5 CGACAATAACGTTGCACTCC 35S-F CCGACAGTGGTCCCAAAGATGGAC 162 Vollenhofer et al. (1999)ATATAGAGGAAGGGTCTTGCGAAGG 35S-R evaluasi, Spektrofotometer NanoPhotometer (Implen, München, Jerman) digunakan. Absorbancy di 260 nm, 280 nm, dan 320 nm diukur dan spektrum profil (dari 200 nm 760 nm) tercatat. Kemurnian dihitung berdasarkan rasio A260/A280.PCR. DNA amplifiability diverifikasi oleh amplifikasi 211 pb bentangan panjang spesies gen tertentu papain. Untuk urutan primer Lihat tabel 1.Deteksi Papain. Amplifikasi reaksi (25 μL) dilakukan menggunakan reagen AmpliTaq emas PCR (Biosystems diterapkan, Forster City, Amerika Serikat). Akhir PCR komponen adalah sebagai berikut: emas penyangga 1 ×; MgCl2 2mM; dNPTs (Fer-mentas, Burlington, Kanada) 0.2 mM; primer papain 1-3 0.5µM; primer papain 1-5 0.5µM; AmpliTaq emas polimerase 1 U. Volume telah disesuaikan dengan air untuk PCR untuk 20 μL. PCR ini dilakukan dengan menggunakan 5 μL template DNA (DNA ng 100 di reac-tion dalam genom kontrol positif atau 10 ng DNA dalam kasus plasmid positif kontrol).Amplifikasi dilakukan di pengendara-sepeda termal PCR (MJ penelitian, Waltham, Amerika Serikat) dan terdiri dari: 12 min pada 95° C; 41 siklus dengan 30 s di 95° C, 30 s di 60° C, 30 s di 72° C dan 10 min di 72° C.Deteksi CaMV 35S promotor. Untuk trojanny-tion transgenik urutan, 162 bp serangkaian 35S Promotor CaMV digunakan. Untuk urutan primer Lihat tabel 1. Amplifikasi reaksi (25 μL) dilakukan menggunakan reagen AmpliTaq emas PCR (Biosystems diterapkan, Forster City, Amerika Serikat). Akhir con-centrations PCR komponen adalah sebagai berikut: emas penyangga 1 ×; MgCl2 1.5 mM; dNPTs (Fermen-tas, Burlington, Kanada) 0.2 mM; primer 35S-F 0.24µM; primer 35S-R 0.24µM; AmpliTaq emas polimerase 1 U. Volume telah disesuaikan dengan air untuk PCR untuk 20 μL. PCR ini dilakukan dengan menggunakan 5 μL template DNA (100 ng DNA dalam reac