Czech J. Food Sci. Vol. 27, 2009, S

Czech J. Food Sci. Vol. 27, 2009, Special Issue 2: S2-75–S2-81

Table 1. Primers used in PCR

Primer Sequence (5'-3') Product size (bp) Source
Papain 1–3 GGGCATTCTCAGCTGTTGTA 211 Goda et al. (2001)
Papain 1–5 CGACAATAACGTTGCACTCC
35S-F CCGACAGTGGTCCCAAAGATGGAC 162 Vollenhofer et al. (1999)
35S-R ATATAGAGGAAGGGTCTTGCGAAGG


evaluation, spectrophotometer NanoPhotometer (Implen, Munich, Germany) was used. Absorbancy at 260 nm, 280 nm, and 320 nm was measured and spectra profile (from 190 nm to 760 nm) recorded. Purity was calculated based on A260/A280 ratios.

PCR. The DNA amplifiability was verified by amplification of 211 pb long stretch of species specific gene papain. For primer sequence see Table 1.

Detection of papain. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End concentrations of PCR components were as follow: Gold buffer 1×; MgCl2 2mM; dNPTs (Fer-mentas, Burlington, Canada) 0.2mM; primer papain 1–3 0.5µM; primer papain 1–5 0.5µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reac-tion in case of genomic positive control or 10 ng DNA in case of plasmid positive control).

Amplification was performed in PCR thermal cycler (MJ Research, Waltham, USA) and consisted of: 12 min at 95°C; 41 cycles with 30 s at 95°C, 30 s at 60°C, 30 s at 72°C and 10 min at 72°C.

Detection of CaMV 35S promoter. For detec-tion of transgenic sequence, 162 bp string of 35S


CaMV promoter was used. For primer sequence see Table 1. Amplification reactions (25 µl) were performed using AmpliTaq Gold PCR reagents (Applied Biosystems, Forster City, USA). End con-centrations of PCR components were as follow: Gold buffer 1×; MgCl2 1.5mM; dNPTs (Fermen-tas, Burlington, Canada) 0.2mM; primer 35S-F 0.24µM; primer 35S- R 0.24µM; AmpliTaq Gold polymerase 1 U. The volume was adjusted with water for PCR to 20 µl. PCR was performed using 5 µl of template DNA (100 ng DNA in reaction in case of positive controls).

Amplification was performed in PCR thermal cycler MJTB (MJ Research, Waltham, USA) and consisted of: 12 min at 95°C; 41 cycles with 30 s at 95°C, 30 s at 66°C, 30 s at 72°C; and s 10 min at 72°C.
Data evaluation. All isolations and amplifica-tions were run in duplicates. Positive, extraction and MasterMix controls were always included. As the positive control for papaya internal gene ampli-fication, the plasmid containing papain target se-quence was used. This plasmid (pPCR® 2.1-TOPO®) was prepared in our laboratory by insertion of 211 bp of papain target sequence using TOPO® TA Cloning Kit (Invitrogen, Carlsbad, USA). Al-ternativelly, isolated DNA from transgenic papaya


Table 2. Spectrophotometry measurement of isolated DNAs

Papaya matrix DNA isolation protocol Gel elfo DNA quantity (ng/µl) Amplifiability
CTAB – 1 +
Flesh Wizard – – –
GeneSpin – – –
CTAB + 7 +
Stone Wizard – – –
GeneSpin – – –
CTAB – – –
Candied Wizard – – –
GeneSpin – – +